Transcript: Human NM_005320.2

Homo sapiens H1.3 linker histone, cluster member (H1-3), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
H1-3 (3007)
Length:
777
CDS:
56..721

Additional Resources:

NCBI RefSeq record:
NM_005320.2
NBCI Gene record:
H1-3 (3007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433025 GTATCTGAGCTTATCACCAAG pLKO_005 176 CDS 100% 4.050 5.670 N H1-3 n/a
2 TRCN0000438267 GAAAGTGGCCAAGAGTGCGAA pLKO_005 562 CDS 100% 2.640 3.696 N H1-3 n/a
3 TRCN0000415938 AGCTTGGTGAGCAAAGGTACT pLKO_005 314 CDS 100% 4.050 2.835 N H1-3 n/a
4 TRCN0000106802 GCAAAGGTACTCTGGTGCAGA pLKO.1 324 CDS 100% 2.640 1.848 N H1-3 n/a
5 TRCN0000106800 CCATTCCTGCACCCGCAGAAA pLKO.1 84 CDS 100% 1.650 1.155 N H1-3 n/a
6 TRCN0000106801 CCTAAGAAGGTAAAGAAGCCA pLKO.1 521 CDS 100% 0.750 0.525 N H1-3 n/a
7 TRCN0000106803 GCAGGCGCAACTGCTGGGAAA pLKO.1 134 CDS 100% 0.000 0.000 N H1-3 n/a
8 TRCN0000106804 CTCCTTCAAACTCAACAAGAA pLKO.1 367 CDS 100% 4.950 2.970 N H1-3 n/a
9 TRCN0000443826 ACTGCTGGGAAACGCAAAGCA pLKO_005 143 CDS 100% 3.000 1.800 N H1-3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005320.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.