Transcript: Human NM_005379.4

Homo sapiens myosin IA (MYO1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MYO1A (4640)
Length:
3633
CDS:
264..3395

Additional Resources:

NCBI RefSeq record:
NM_005379.4
NBCI Gene record:
MYO1A (4640)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005379.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083864 GCCCGAAAGAATTATCGCAAA pLKO.1 2538 CDS 100% 4.050 5.670 N MYO1A n/a
2 TRCN0000437047 AGAATGCCCAGCGTCAGTATG pLKO_005 1726 CDS 100% 10.800 8.640 N MYO1A n/a
3 TRCN0000083867 CGGTGGTGTCATCACAAACTA pLKO.1 785 CDS 100% 5.625 4.500 N MYO1A n/a
4 TRCN0000083865 CCGAAAGAATTATCGCAAATA pLKO.1 2540 CDS 100% 13.200 9.240 N MYO1A n/a
5 TRCN0000083863 TCCTCCTGAACCAGCACTAAT pLKO.1 3428 3UTR 100% 13.200 9.240 N MYO1A n/a
6 TRCN0000429763 TGCCATCCACAAACGTCTTAG pLKO_005 2647 CDS 100% 10.800 7.560 N MYO1A n/a
7 TRCN0000083866 CCCAACTACATCAGGTGCATA pLKO.1 2010 CDS 100% 4.950 3.465 N MYO1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005379.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.