Transcript: Human NM_005413.4

Homo sapiens SIX homeobox 3 (SIX3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SIX3 (6496)
Length:
2713
CDS:
404..1402

Additional Resources:

NCBI RefSeq record:
NM_005413.4
NBCI Gene record:
SIX3 (6496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005413.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424041 TGATTTAAAGAGTCGACTATA pLKO_005 1844 3UTR 100% 13.200 18.480 N SIX3 n/a
2 TRCN0000015309 GCGACTCGGAATGTGATGTAT pLKO.1 1380 CDS 100% 5.625 7.875 N SIX3 n/a
3 TRCN0000428202 ATCAACAAACACGAGTCGATC pLKO_005 776 CDS 100% 4.050 5.670 N SIX3 n/a
4 TRCN0000015308 CCCACCTGCATGACGATTTAT pLKO.1 1789 3UTR 100% 15.000 10.500 N SIX3 n/a
5 TRCN0000015312 AGTAGGCAACTGGTTTAAGAA pLKO.1 1150 CDS 100% 5.625 3.938 N SIX3 n/a
6 TRCN0000070784 CCACTTCTTGTTGCCAAACTT pLKO.1 439 CDS 100% 5.625 3.938 N Six3 n/a
7 TRCN0000015311 CCCGGAAGAGTTGTCCATGTT pLKO.1 622 CDS 100% 4.950 3.465 N SIX3 n/a
8 TRCN0000412565 TTGCCAAACTTCGCCGATTCT pLKO_005 449 CDS 100% 4.950 3.465 N SIX3 n/a
9 TRCN0000015310 GCTCCATACTTCTGGCGAGTA pLKO.1 477 CDS 100% 4.050 2.835 N SIX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005413.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.