Transcript: Human NM_005475.3

Homo sapiens SH2B adaptor protein 3 (SH2B3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
SH2B3 (10019)
Length:
5431
CDS:
383..2110

Additional Resources:

NCBI RefSeq record:
NM_005475.3
NBCI Gene record:
SH2B3 (10019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005475.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256099 TCCTGGTGCCTTACGAATAAA pLKO_005 2973 3UTR 100% 15.000 21.000 N SH2B3 n/a
2 TRCN0000265765 CCTAGGCCCTTTCTAGTAAAT pLKO_005 3082 3UTR 100% 13.200 18.480 N SH2B3 n/a
3 TRCN0000256096 ACACGGTCCTCTTCCCTTTCT pLKO_005 1800 CDS 100% 4.950 6.930 N SH2B3 n/a
4 TRCN0000116285 CGGACTACGAAATGGACTCAT pLKO.1 2040 CDS 100% 4.950 6.930 N SH2B3 n/a
5 TRCN0000256095 TTCGACCCACCCAAGAGTTCA pLKO_005 1100 CDS 100% 4.950 6.930 N SH2B3 n/a
6 TRCN0000265706 TCCCTTAACCAAGGTGCTTCT pLKO_005 1391 CDS 100% 4.050 5.670 N SH2B3 n/a
7 TRCN0000265720 TGCCAGAAGACGGACCATTTC pLKO_005 1436 CDS 100% 10.800 8.640 N SH2B3 n/a
8 TRCN0000265716 ACGTGCTCACTTTCAACTTTC pLKO_005 1584 CDS 100% 10.800 7.560 N SH2B3 n/a
9 TRCN0000116286 GACCGGACAGACATCATCTTT pLKO.1 1223 CDS 100% 5.625 3.938 N SH2B3 n/a
10 TRCN0000116282 CCCAGTAGATAATGAACCAAA pLKO.1 4278 3UTR 100% 4.950 3.465 N SH2B3 n/a
11 TRCN0000116283 CCTGACAACCTTTACACCTTT pLKO.1 1187 CDS 100% 4.950 3.465 N SH2B3 n/a
12 TRCN0000256098 CTGGAGCATGAGCCTGTGAAT pLKO_005 2006 CDS 100% 4.950 3.465 N SH2B3 n/a
13 TRCN0000265715 GGGCCATAGACAATCAGTACA pLKO_005 2079 CDS 100% 4.950 3.465 N SH2B3 n/a
14 TRCN0000256097 ATATTCCCTCAGCCCTAGAGC pLKO_005 1335 CDS 100% 2.640 1.848 N SH2B3 n/a
15 TRCN0000116284 GCCTGACAACCTTTACACCTT pLKO.1 1186 CDS 100% 2.640 1.848 N SH2B3 n/a
16 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3881 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
17 TRCN0000060503 CCTCTCAAGTAGCTGGGATTA pLKO.1 3851 3UTR 100% 10.800 5.400 Y NCCRP1 n/a
18 TRCN0000155576 CCTCTCAAGTAGCTGGGATTA pLKO.1 3851 3UTR 100% 10.800 5.400 Y KLHL30 n/a
19 TRCN0000165697 CCTCTCAAGTAGCTGGGATTA pLKO.1 3851 3UTR 100% 10.800 5.400 Y SLC48A1 n/a
20 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3915 3UTR 100% 4.950 2.475 Y n/a
21 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3988 3UTR 100% 5.625 2.813 Y KLHL30 n/a
22 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3988 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005475.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.