Transcript: Human NM_005477.3

Homo sapiens hyperpolarization activated cyclic nucleotide gated potassium channel 4 (HCN4), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
HCN4 (10021)
Length:
6922
CDS:
689..4300

Additional Resources:

NCBI RefSeq record:
NM_005477.3
NBCI Gene record:
HCN4 (10021)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440473 CATCAGCCCGTTAGCTGTAAC pLKO_005 4675 3UTR 100% 10.800 15.120 N HCN4 n/a
2 TRCN0000043988 GCGTGGATCATGGACGAGGAA pLKO.1 755 CDS 100% 0.880 0.704 N HCN4 n/a
3 TRCN0000414947 TTAACTGTGATTAGGAGATAT pLKO_005 4360 3UTR 100% 13.200 9.240 N HCN4 n/a
4 TRCN0000043992 ACACCCTGGATTGTCTTCAAT pLKO.1 1565 CDS 100% 5.625 3.938 N HCN4 n/a
5 TRCN0000043991 GAAGACATCCTCAGGTTCTTT pLKO.1 4150 CDS 100% 5.625 3.938 N HCN4 n/a
6 TRCN0000043989 GTGGGAAACCTGATTATCATT pLKO.1 1508 CDS 100% 5.625 3.938 N HCN4 n/a
7 TRCN0000043990 CTACCAGGAGAATGAGATCAT pLKO.1 2893 CDS 100% 4.950 3.465 N HCN4 n/a
8 TRCN0000018094 CGTGGACTACATCTTCCTCAT pLKO.1 1741 CDS 100% 4.050 2.430 N LOC388097 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.