Transcript: Human NM_005513.3

Homo sapiens general transcription factor IIE subunit 1 (GTF2E1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
GTF2E1 (2960)
Length:
3000
CDS:
82..1401

Additional Resources:

NCBI RefSeq record:
NM_005513.3
NBCI Gene record:
GTF2E1 (2960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005513.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020720 CGCATGTTTGAGGACCTCTTT pLKO.1 1375 CDS 100% 4.950 6.930 N GTF2E1 n/a
2 TRCN0000278056 CGCATGTTTGAGGACCTCTTT pLKO_005 1375 CDS 100% 4.950 6.930 N GTF2E1 n/a
3 TRCN0000020719 CCAGCAGAAATCAACAGAATA pLKO.1 2593 3UTR 100% 13.200 9.240 N GTF2E1 n/a
4 TRCN0000277957 CCAGCAGAAATCAACAGAATA pLKO_005 2593 3UTR 100% 13.200 9.240 N GTF2E1 n/a
5 TRCN0000020722 CCATAACTACTACTTCATCAA pLKO.1 345 CDS 100% 4.950 3.465 N GTF2E1 n/a
6 TRCN0000277958 CCATAACTACTACTTCATCAA pLKO_005 345 CDS 100% 4.950 3.465 N GTF2E1 n/a
7 TRCN0000020721 CCTGTGTGAAAGAGGAGGATA pLKO.1 203 CDS 100% 4.950 3.465 N GTF2E1 n/a
8 TRCN0000278022 CCTGTGTGAAAGAGGAGGATA pLKO_005 203 CDS 100% 4.950 3.465 N GTF2E1 n/a
9 TRCN0000020723 GCACTGCTCATTCACGAGAAA pLKO.1 1051 CDS 100% 4.950 2.970 N GTF2E1 n/a
10 TRCN0000286069 GCACTGCTCATTCACGAGAAA pLKO_005 1051 CDS 100% 4.950 2.970 N GTF2E1 n/a
11 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 1796 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005513.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.