Transcript: Human NM_005738.5

Homo sapiens ADP ribosylation factor like GTPase 4A (ARL4A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
ARL4A (10124)
Length:
2889
CDS:
186..788

Additional Resources:

NCBI RefSeq record:
NM_005738.5
NBCI Gene record:
ARL4A (10124)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005738.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245194 GTAGATCCATGATGGATTAAT pLKO_005 2615 3UTR 100% 15.000 10.500 N ARL4A n/a
2 TRCN0000381218 AGGGACAAGGAGTAAGTATTT pLKO_005 1274 3UTR 100% 13.200 9.240 N ARL4A n/a
3 TRCN0000379746 GCAGTTATATTGATCACATTG pLKO_005 1228 3UTR 100% 10.800 7.560 N ARL4A n/a
4 TRCN0000048072 CCTGCCTTCATTTCAGTCTTT pLKO.1 227 CDS 100% 4.950 3.465 N ARL4A n/a
5 TRCN0000100207 CGTACCTACCAAAGGATTTAA pLKO.1 329 CDS 100% 15.000 9.000 N Arl4a n/a
6 TRCN0000325087 CGTACCTACCAAAGGATTTAA pLKO_005 329 CDS 100% 15.000 9.000 N Arl4a n/a
7 TRCN0000048069 CAGTCTTTCCACATTGTTATT pLKO.1 240 CDS 100% 13.200 7.920 N ARL4A n/a
8 TRCN0000381559 TCAGGGAGTCCCTGTACTTAT pLKO_005 557 CDS 100% 13.200 7.920 N ARL4A n/a
9 TRCN0000381201 GAGGAACTCATTGTCACTTTC pLKO_005 599 CDS 100% 10.800 6.480 N ARL4A n/a
10 TRCN0000048070 ACAAGATTTGAGGAACTCATT pLKO.1 590 CDS 100% 4.950 2.970 N ARL4A n/a
11 TRCN0000048071 GCTCATCAACTCCTTGGCATT pLKO.1 655 CDS 100% 4.050 2.430 N ARL4A n/a
12 TRCN0000245193 ACTTGAGAAACTACATGATAT pLKO_005 719 CDS 100% 13.200 6.600 Y ARL4A n/a
13 TRCN0000380213 AGGTGGTCAGGAGAAATTAAG pLKO_005 413 CDS 100% 13.200 6.600 Y ARL4A n/a
14 TRCN0000245190 ATGCACAGATGGCATTGTATT pLKO_005 458 CDS 100% 13.200 6.600 Y ARL4A n/a
15 TRCN0000380964 GGCCACTGTGGAAGTCATATA pLKO_005 433 CDS 100% 13.200 6.600 Y ARL4A n/a
16 TRCN0000245192 AGCCTACCTGTGCAATCATAG pLKO_005 679 CDS 100% 10.800 5.400 Y ARL4A n/a
17 TRCN0000382452 ATCATAGGAGATGGCCTAAAG pLKO_005 693 CDS 100% 10.800 5.400 Y ARL4A n/a
18 TRCN0000379483 CAGAAATTGAGAAATTGTTAG pLKO_005 619 CDS 100% 10.800 5.400 Y ARL4A n/a
19 TRCN0000245191 TACTTATAGTTGCTAACAAAC pLKO_005 571 CDS 100% 10.800 5.400 Y ARL4A n/a
20 TRCN0000380147 TATACAGGCTGCAGTTCAATG pLKO_005 295 CDS 100% 10.800 5.400 Y ARL4A n/a
21 TRCN0000381439 TCATCAACTCCTTGGCATTTG pLKO_005 657 CDS 100% 10.800 5.400 Y ARL4A n/a
22 TRCN0000381196 TGTCCAACCTGCCTTCATTTC pLKO_005 220 CDS 100% 10.800 5.400 Y ARL4A n/a
23 TRCN0000381358 GGTTTGGACTGTGCTGGAAAG pLKO_005 264 CDS 100% 6.000 3.000 Y ARL4A n/a
24 TRCN0000382103 ATTGTTAGCAATGGGTGAACT pLKO_005 632 CDS 100% 4.950 2.475 Y ARL4A n/a
25 TRCN0000048068 CCCTGTACTTATAGTTGCTAA pLKO.1 566 CDS 100% 4.950 2.475 Y ARL4A n/a
26 TRCN0000381096 GGGTGAACTGAGCTCATCAAC pLKO_005 644 CDS 100% 4.950 2.475 Y ARL4A n/a
27 TRCN0000382491 GTATTTGTTGTGGACTCTGTT pLKO_005 474 CDS 100% 4.950 2.475 Y ARL4A n/a
28 TRCN0000381342 TGGCCTAAAGGAAGGACTTGA pLKO_005 704 CDS 100% 4.950 2.475 Y ARL4A n/a
29 TRCN0000379621 GACTCTGTTGATGTCGAAAGG pLKO_005 486 CDS 100% 4.050 2.025 Y ARL4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005738.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.