Transcript: Human NM_005791.3

Homo sapiens M-phase phosphoprotein 10 (MPHOSPH10), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MPHOSPH10 (10199)
Length:
2164
CDS:
33..2078

Additional Resources:

NCBI RefSeq record:
NM_005791.3
NBCI Gene record:
MPHOSPH10 (10199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159553 CTTAGACCATGAGAAGAGTAA pLKO.1 1409 CDS 100% 4.950 3.960 N MPHOSPH10 n/a
2 TRCN0000162488 CAGTAGCTTCGGAGAAGTTAA pLKO.1 1870 CDS 100% 13.200 9.240 N MPHOSPH10 n/a
3 TRCN0000281143 CAGTAGCTTCGGAGAAGTTAA pLKO_005 1870 CDS 100% 13.200 9.240 N MPHOSPH10 n/a
4 TRCN0000192440 CCTTAGACCATGAGAAGAGTA pLKO.1 1408 CDS 100% 4.950 3.465 N Mphosph10 n/a
5 TRCN0000158646 CTGGATTCAAACAAAGAAGAT pLKO.1 891 CDS 100% 4.950 3.465 N MPHOSPH10 n/a
6 TRCN0000281140 CTGGATTCAAACAAAGAAGAT pLKO_005 891 CDS 100% 4.950 3.465 N MPHOSPH10 n/a
7 TRCN0000163143 GATGACAAGGAGGACCTAGAA pLKO.1 405 CDS 100% 4.950 3.465 N MPHOSPH10 n/a
8 TRCN0000281142 GATGACAAGGAGGACCTAGAA pLKO_005 405 CDS 100% 4.950 3.465 N MPHOSPH10 n/a
9 TRCN0000163780 GCACCTGTGATTACAGAGGAA pLKO.1 1272 CDS 100% 2.640 1.848 N MPHOSPH10 n/a
10 TRCN0000281141 GCACCTGTGATTACAGAGGAA pLKO_005 1272 CDS 100% 2.640 1.848 N MPHOSPH10 n/a
11 TRCN0000159968 GAATGCAGTTAGTGAAACAAT pLKO.1 308 CDS 100% 5.625 3.375 N MPHOSPH10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005791.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.