Transcript: Human NM_005886.3

Homo sapiens katanin regulatory subunit B1 (KATNB1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KATNB1 (10300)
Length:
2618
CDS:
353..2320

Additional Resources:

NCBI RefSeq record:
NM_005886.3
NBCI Gene record:
KATNB1 (10300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005886.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116381 CGCCGAGGACTACAACGAGAT pLKO.1 1486 CDS 100% 1.350 1.890 N KATNB1 n/a
2 TRCN0000116378 GCTCTGCTACAAGCAGCTTAA pLKO.1 2203 CDS 100% 10.800 7.560 N KATNB1 n/a
3 TRCN0000116377 AGCCCTGAACTCTTGAGACAA pLKO.1 2481 3UTR 100% 4.950 3.465 N KATNB1 n/a
4 TRCN0000437463 CGTCAACCTGTGGTCCATCAA pLKO_005 484 CDS 100% 4.950 3.465 N KATNB1 n/a
5 TRCN0000437546 GACCTCCTGAACATCGTCAAC pLKO_005 1967 CDS 100% 4.050 2.835 N KATNB1 n/a
6 TRCN0000438454 TGATGTGGTCCTCGTCAACTG pLKO_005 1147 CDS 100% 4.050 2.835 N KATNB1 n/a
7 TRCN0000091097 GCAGAGCAAGTATGAGAGCTA pLKO.1 2053 CDS 100% 2.640 1.848 N Katnb1 n/a
8 TRCN0000116380 GCGAGTTTGTAGCCTCTGGTT pLKO.1 702 CDS 100% 2.640 1.848 N KATNB1 n/a
9 TRCN0000116379 CGGCAAGATGATGTCTGAGTT pLKO.1 886 CDS 100% 4.950 2.970 N KATNB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005886.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07584 pDONR223 99.2% 99.9% 100% None 726C>T n/a
2 ccsbBroad304_07584 pLX_304 0% 99.9% 100% V5 726C>T n/a
Download CSV