Transcript: Human NM_005907.4

Homo sapiens mannosidase alpha class 1A member 1 (MAN1A1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
MAN1A1 (4121)
Length:
5018
CDS:
443..2404

Additional Resources:

NCBI RefSeq record:
NM_005907.4
NBCI Gene record:
MAN1A1 (4121)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005907.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378329 TCTAGCAGCGGACTAACTTAT pLKO_005 1796 CDS 100% 13.200 18.480 N MAN1A1 n/a
2 TRCN0000049600 CCTTTATCCTAACTATCTGAA pLKO.1 1606 CDS 100% 4.950 6.930 N MAN1A1 n/a
3 TRCN0000049598 CGAGACTCATTTGATCCGCAA pLKO.1 1774 CDS 100% 2.160 3.024 N MAN1A1 n/a
4 TRCN0000359712 CCCTTCACTGTATACCTTAAT pLKO_005 2436 3UTR 100% 13.200 9.240 N MAN1A1 n/a
5 TRCN0000359711 GACCTAAATTCCTTATCATAT pLKO_005 2566 3UTR 100% 13.200 9.240 N MAN1A1 n/a
6 TRCN0000359778 GACTACTCTCAGCCTACTATC pLKO_005 1305 CDS 100% 10.800 7.560 N MAN1A1 n/a
7 TRCN0000049599 GCAGAGTGAATGGAGGCTATT pLKO.1 2178 CDS 100% 10.800 7.560 N MAN1A1 n/a
8 TRCN0000055383 CGAAAGAAAGCAGTGGAACTT pLKO.1 1346 CDS 100% 4.950 3.465 N Man1a n/a
9 TRCN0000049601 GCTGGTATTCAGCGCCTTCAT pLKO.1 577 CDS 100% 4.950 3.465 N MAN1A1 n/a
10 TRCN0000049602 GTAACATCAAAGGAGCAACTA pLKO.1 1143 CDS 100% 4.950 3.465 N MAN1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005907.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10957 pDONR223 100% 50.2% 49.2% None (many diffs) n/a
2 ccsbBroad304_10957 pLX_304 0% 50.2% 49.2% V5 (many diffs) n/a
Download CSV