Transcript: Human NM_005961.3

Homo sapiens mucin 6, oligomeric mucus/gel-forming (MUC6), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MUC6 (4588)
Length:
8016
CDS:
64..7383

Additional Resources:

NCBI RefSeq record:
NM_005961.3
NBCI Gene record:
MUC6 (4588)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005961.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243187 CCTGAATGACCTCTCCAATAA pLKO_005 1086 CDS 100% 13.200 9.240 N MUC6 n/a
2 TRCN0000243190 GGCTCCTTTGTTACCACATTT pLKO_005 1267 CDS 100% 13.200 9.240 N MUC6 n/a
3 TRCN0000243189 ACCTGCCACAGCAAGGTATAC pLKO_005 3274 CDS 100% 10.800 7.560 N MUC6 n/a
4 TRCN0000243188 CAACTTCTACTACCACGATTA pLKO_005 4679 CDS 100% 10.800 7.560 N MUC6 n/a
5 TRCN0000243186 GGAAGGTGACCAACGAGTTTG pLKO_005 605 CDS 100% 10.800 7.560 N MUC6 n/a
6 TRCN0000148687 CTCACACAGTCATCATCACTA pLKO.1 6125 CDS 100% 4.950 2.970 N MUC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005961.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.