Transcript: Human NM_005964.4

Homo sapiens myosin heavy chain 10 (MYH10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
MYH10 (4628)
Length:
7626
CDS:
104..6034

Additional Resources:

NCBI RefSeq record:
NM_005964.4
NBCI Gene record:
MYH10 (4628)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005964.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123075 GCTCGGATGAAGCAGCTTAAA pLKO.1 5732 CDS 100% 13.200 18.480 N MYH10 n/a
2 TRCN0000299024 GCTCGGATGAAGCAGCTTAAA pLKO_005 5732 CDS 100% 13.200 18.480 N MYH10 n/a
3 TRCN0000123074 CGGGATTCCTTCCTGAAAGAT pLKO.1 6122 3UTR 100% 5.625 3.938 N MYH10 n/a
4 TRCN0000299025 CGGGATTCCTTCCTGAAAGAT pLKO_005 6122 3UTR 100% 5.625 3.938 N MYH10 n/a
5 TRCN0000123078 GCAGCTAGTCTTGAGTCTCAA pLKO.1 4031 CDS 100% 4.950 3.465 N MYH10 n/a
6 TRCN0000299095 GCAGCTAGTCTTGAGTCTCAA pLKO_005 4031 CDS 100% 4.950 3.465 N MYH10 n/a
7 TRCN0000123076 GCCAACATTGAAACATACCTT pLKO.1 878 CDS 100% 3.000 2.100 N MYH10 n/a
8 TRCN0000299094 GCCAACATTGAAACATACCTT pLKO_005 878 CDS 100% 3.000 2.100 N MYH10 n/a
9 TRCN0000123077 GCACATATTCAGGACCTGGAA pLKO.1 2951 CDS 100% 2.640 1.848 N MYH10 n/a
10 TRCN0000299027 GCACATATTCAGGACCTGGAA pLKO_005 2951 CDS 100% 2.640 1.848 N MYH10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005964.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.