Transcript: Human NM_006015.6

Homo sapiens AT-rich interaction domain 1A (ARID1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
ARID1A (8289)
Length:
8595
CDS:
390..7247

Additional Resources:

NCBI RefSeq record:
NM_006015.6
NBCI Gene record:
ARID1A (8289)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006015.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344709 CGTAATGACATGACCTATAAT pLKO_005 4890 CDS 100% 15.000 21.000 N ARID1A n/a
2 TRCN0000071394 GCATGTCCTATGAGCCAAATA pLKO.1 4057 CDS 100% 13.200 18.480 N Arid1a n/a
3 TRCN0000358684 TATCCCTATGGAGGTCCTTAT pLKO_005 4224 CDS 100% 10.800 15.120 N ARID1A n/a
4 TRCN0000240070 TGGACCTCTATCGCCTCTATG pLKO_005 3535 CDS 100% 10.800 15.120 N LOC675933 n/a
5 TRCN0000358749 TGGACCTCTATCGCCTCTATG pLKO_005 3535 CDS 100% 10.800 15.120 N ARID1A n/a
6 TRCN0000059091 CCGTTGATGAACTCATTGGTT pLKO.1 7182 CDS 100% 3.000 4.200 N ARID1A n/a
7 TRCN0000333242 CCGTTGATGAACTCATTGGTT pLKO_005 7182 CDS 100% 3.000 4.200 N ARID1A n/a
8 TRCN0000238303 TGCCCAAGATCGAGGTTATAT pLKO_005 2627 CDS 100% 15.000 12.000 N Arid1a n/a
9 TRCN0000344652 ACAGGGCCAGACTCCATATTA pLKO_005 1781 CDS 100% 15.000 10.500 N ARID1A n/a
10 TRCN0000240071 ACTGACTGTTGCCCTTTATTT pLKO_005 7304 3UTR 100% 15.000 10.500 N LOC675933 n/a
11 TRCN0000071397 CATTGGTTTCACAAGTCATTT pLKO.1 7195 CDS 100% 13.200 9.240 N Arid1a n/a
12 TRCN0000059089 GCCTGATCTATCTGGTTCAAT pLKO.1 2306 CDS 100% 5.625 3.938 N ARID1A n/a
13 TRCN0000059088 CGGCTCACAATGAAAGACATT pLKO.1 5361 CDS 100% 4.950 3.465 N ARID1A n/a
14 TRCN0000059090 CCTCTCTTATACACAGCAGAT pLKO.1 1721 CDS 100% 4.050 2.835 N ARID1A n/a
15 TRCN0000059092 GCAGCCAAACTATAATGCCTT pLKO.1 2822 CDS 100% 2.640 1.848 N ARID1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006015.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.