Transcript: Human NM_006045.3

Homo sapiens ATPase phospholipid transporting 9A (putative) (ATP9A), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ATP9A (10079)
Length:
7862
CDS:
22..3165

Additional Resources:

NCBI RefSeq record:
NM_006045.3
NBCI Gene record:
ATP9A (10079)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006045.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050736 CGATCGTATGTGTACGCAGAA pLKO.1 679 CDS 100% 4.050 5.670 N ATP9A n/a
2 TRCN0000050734 CCTGGTGTTCTTACACGAGTT pLKO.1 3003 CDS 100% 4.050 2.835 N ATP9A n/a
3 TRCN0000050733 GCTGGCATTGTGCAGTACAAT pLKO.1 1744 CDS 100% 0.563 0.394 N ATP9A n/a
4 TRCN0000050737 CCTTTCACCTATGAAAGCAAA pLKO.1 1648 CDS 100% 0.495 0.347 N ATP9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006045.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.