Transcript: Human NM_006236.3

Homo sapiens POU class 3 homeobox 3 (POU3F3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
POU3F3 (5455)
Length:
4460
CDS:
1397..2899

Additional Resources:

NCBI RefSeq record:
NM_006236.3
NBCI Gene record:
POU3F3 (5455)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010965 CGCCGCAGAGTCTGCTCTACT pLKO.1 2043 CDS 100% 0.000 0.000 N POU3F3 n/a
2 TRCN0000005753 GATGGTCCAGAGCGACTTCAT pLKO.1 1609 CDS 100% 4.950 3.465 N POU3F3 n/a
3 TRCN0000349003 GATGGTCCAGAGCGACTTCAT pLKO_005 1609 CDS 100% 4.950 3.465 N Pou3f3 n/a
4 TRCN0000433977 CACACTCTACGGCAACGTGTT pLKO_005 2440 CDS 100% 4.050 2.835 N POU3F3 n/a
5 TRCN0000418161 ACCCGTCCTCTGTCAAGATGG pLKO_005 1593 CDS 100% 1.350 0.945 N POU3F3 n/a
6 TRCN0000005754 CGGCTCTATTGTGCACTCGGA pLKO.1 1450 CDS 100% 0.220 0.154 N POU3F3 n/a
7 TRCN0000005755 CGCGCAGGAGATCACCAACCT pLKO.1 2692 CDS 100% 0.000 0.000 N POU3F3 n/a
8 TRCN0000010964 GCCCGGAGGCTTCACGGTGAA pLKO.1 2068 CDS 100% 0.000 0.000 N POU3F3 n/a
9 TRCN0000427199 TCTGTCAAGATGGTCCAGAGC pLKO_005 1601 CDS 100% 2.160 1.296 N POU3F3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.