Transcript: Human NM_006351.4

Homo sapiens translocase of inner mitochondrial membrane 44 (TIMM44), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TIMM44 (10469)
Length:
1843
CDS:
16..1374

Additional Resources:

NCBI RefSeq record:
NM_006351.4
NBCI Gene record:
TIMM44 (10469)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433011 TGGTGCTATGAAGCTACTTAC pLKO_005 1039 CDS 100% 10.800 15.120 N TIMM44 n/a
2 TRCN0000437489 CGAAAGCGACAACGCGTTCAT pLKO_005 813 CDS 100% 4.950 6.930 N TIMM44 n/a
3 TRCN0000164155 CGTGGTGTTTAACCGGTTCTT pLKO.1 771 CDS 100% 4.950 6.930 N TIMM44 n/a
4 TRCN0000164399 CCGGTTCTTCGAGATGAAGAT pLKO.1 783 CDS 100% 0.495 0.693 N TIMM44 n/a
5 TRCN0000162666 CGGCTTGCTAGATAATGTCAA pLKO.1 198 CDS 100% 4.950 3.960 N TIMM44 n/a
6 TRCN0000164348 CCTGTTCTCCAAGACAGAGAT pLKO.1 882 CDS 100% 4.950 3.465 N TIMM44 n/a
7 TRCN0000161169 GAAGGACTTCAAGGAGAACAA pLKO.1 750 CDS 100% 4.950 3.465 N TIMM44 n/a
8 TRCN0000158806 GATAAGTTCAAGGAGGAGAAA pLKO.1 661 CDS 100% 4.950 3.465 N TIMM44 n/a
9 TRCN0000444202 TCCAGACCTCTGGGAACAAGA pLKO_005 1449 3UTR 100% 4.950 3.465 N TIMM44 n/a
10 TRCN0000445747 ACACAGGTCACACAGTGCCAA pLKO_005 1640 3UTR 100% 2.640 1.848 N TIMM44 n/a
11 TRCN0000161907 GAGTCCGTGAAGAAGGAAATT pLKO.1 565 CDS 100% 13.200 7.920 N TIMM44 n/a
12 TRCN0000163097 GCTGCCACTGTCCAAATCATA pLKO.1 147 CDS 100% 5.625 3.375 N TIMM44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02445 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02445 pLX_304 0% 100% 100% V5 n/a
Download CSV