Transcript: Human NM_006580.3

Homo sapiens claudin 16 (CLDN16), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CLDN16 (10686)
Length:
3290
CDS:
249..1166

Additional Resources:

NCBI RefSeq record:
NM_006580.3
NBCI Gene record:
CLDN16 (10686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433868 TCAATCAGTATGGTTACATTG pLKO_005 1203 3UTR 100% 10.800 15.120 N CLDN16 n/a
2 TRCN0000117121 CGTACATTAAAGTCCGCATCT pLKO.1 787 CDS 100% 4.050 5.670 N CLDN16 n/a
3 TRCN0000117117 GCACACACTTTCCCTATATTT pLKO.1 1378 3UTR 100% 15.000 10.500 N CLDN16 n/a
4 TRCN0000419219 TCAATCCAGGAACAGTTATTT pLKO_005 1237 3UTR 100% 15.000 10.500 N CLDN16 n/a
5 TRCN0000117119 CCTGAGAGAAACTATCCTTAT pLKO.1 1041 CDS 100% 10.800 7.560 N CLDN16 n/a
6 TRCN0000422479 CTGACTGTTGGATGGTGAATG pLKO_005 535 CDS 100% 10.800 7.560 N CLDN16 n/a
7 TRCN0000117118 GCAGATATTCTAGCTGGGTTT pLKO.1 711 CDS 100% 4.050 2.835 N CLDN16 n/a
8 TRCN0000117120 CCACGTTACTAATAGCAGGTA pLKO.1 823 CDS 100% 2.640 1.848 N CLDN16 n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2206 3UTR 100% 4.950 2.475 Y ORAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02507 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02507 pLX_304 0% 100% 100% V5 n/a
Download CSV