Transcript: Human NM_006763.3

Homo sapiens BTG anti-proliferation factor 2 (BTG2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
BTG2 (7832)
Length:
2729
CDS:
89..565

Additional Resources:

NCBI RefSeq record:
NM_006763.3
NBCI Gene record:
BTG2 (7832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231891 GGTCATAGAGCTACCGTATTT pLKO_005 1578 3UTR 100% 13.200 18.480 N BTG2 n/a
2 TRCN0000231596 CACTCACAGAGCACTACAAAC pLKO_005 222 CDS 100% 10.800 7.560 N BTG2 n/a
3 TRCN0000231598 ATGAGGTGTCCTACCGCATTG pLKO_005 408 CDS 100% 6.000 4.200 N BTG2 n/a
4 TRCN0000231595 AGCAGAGGCTTAAGGTCTTCA pLKO_005 183 CDS 100% 4.950 3.465 N BTG2 n/a
5 TRCN0000007625 CACTACAAACACCACTGGTTT pLKO.1 233 CDS 100% 4.950 3.465 N BTG2 n/a
6 TRCN0000007624 CCTACTGTCCTAAGCTGCTTT pLKO.1 1133 3UTR 100% 4.950 3.465 N BTG2 n/a
7 TRCN0000231597 CTACCGCTGCATTCGCATCAA pLKO_005 280 CDS 100% 4.950 3.465 N BTG2 n/a
8 TRCN0000007628 CGTGAGCGAGCAGAGGCTTAA pLKO.1 175 CDS 100% 3.600 2.520 N BTG2 n/a
9 TRCN0000007627 CAAGAACTACGTGATGGCAGT pLKO.1 535 CDS 100% 2.160 1.512 N BTG2 n/a
10 TRCN0000007626 CTATGAGGTGTCCTACCGCAT pLKO.1 406 CDS 100% 2.160 1.512 N BTG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.