Transcript: Human NM_006769.4

Homo sapiens LIM domain only 4 (LMO4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LMO4 (8543)
Length:
4993
CDS:
369..866

Additional Resources:

NCBI RefSeq record:
NM_006769.4
NBCI Gene record:
LMO4 (8543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006769.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013240 GATCGGTTTCACTACATCAAT pLKO.1 744 CDS 100% 5.625 7.875 N LMO4 n/a
2 TRCN0000285173 GATCGGTTTCACTACATCAAT pLKO_005 744 CDS 100% 5.625 7.875 N LMO4 n/a
3 TRCN0000013238 CCGCATTTATTGGTGTATTAA pLKO.1 1017 3UTR 100% 15.000 10.500 N LMO4 n/a
4 TRCN0000232245 TACATCAATGGCAGTTTATTT pLKO_005 756 CDS 100% 15.000 10.500 N Lmo4 n/a
5 TRCN0000232243 ATGACTACATTAGGTTATTTG pLKO_005 592 CDS 100% 13.200 9.240 N Lmo4 n/a
6 TRCN0000013241 CACTACATCAATGGCAGTTTA pLKO.1 753 CDS 100% 13.200 9.240 N LMO4 n/a
7 TRCN0000360501 TCTACCCTCATTAACAATTAG pLKO_005 1202 3UTR 100% 13.200 9.240 N Lmo4 n/a
8 TRCN0000274247 TCTATGCCATGGACAGCTATT pLKO_005 475 CDS 100% 10.800 7.560 N LMO4 n/a
9 TRCN0000274248 TGTTGTAAGGAAACGTGTTTC pLKO_005 1295 3UTR 100% 10.800 7.560 N LMO4 n/a
10 TRCN0000084376 CTTTGCAGAAATGACTACATT pLKO.1 582 CDS 100% 5.625 3.938 N Lmo4 n/a
11 TRCN0000013239 GCGCAAGGCAATGTGTATCAT pLKO.1 675 CDS 100% 5.625 3.938 N LMO4 n/a
12 TRCN0000285171 GCGCAAGGCAATGTGTATCAT pLKO_005 675 CDS 100% 5.625 3.938 N LMO4 n/a
13 TRCN0000084374 CCTTTGCAGAAATGACTACAT pLKO.1 581 CDS 100% 4.950 3.465 N Lmo4 n/a
14 TRCN0000013242 CAGAAATGACTACATTAGGTT pLKO.1 587 CDS 100% 3.000 2.100 N LMO4 n/a
15 TRCN0000274250 CAGAAATGACTACATTAGGTT pLKO_005 587 CDS 100% 3.000 2.100 N LMO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006769.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07259 pDONR223 100% 99.5% 99.3% None 488A>C;492C>T n/a
2 ccsbBroad304_07259 pLX_304 0% 99.5% 99.3% V5 488A>C;492C>T n/a
Download CSV