Transcript: Human NM_006902.5

Homo sapiens paired related homeobox 1 (PRRX1), transcript variant pmx-1a, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PRRX1 (5396)
Length:
4133
CDS:
89..742

Additional Resources:

NCBI RefSeq record:
NM_006902.5
NBCI Gene record:
PRRX1 (5396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006902.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220236 AGCAGCGAAGGAATAGGACAA pLKO.1 366 CDS 100% 4.050 5.670 N PRRX1 n/a
2 TRCN0000436440 ATAACGGATTCTAACGGAAGA pLKO_005 729 CDS 100% 4.050 5.670 N PRRX1 n/a
3 TRCN0000220235 GAGAGCCATGCTAGCCAATAA pLKO.1 547 CDS 100% 13.200 10.560 N PRRX1 n/a
4 TRCN0000220234 GCAGGCTTTGGAGCGTGTCTT pLKO.1 406 CDS 100% 1.650 1.320 N PRRX1 n/a
5 TRCN0000431392 ACCTATCCTGCTCTGTTATTT pLKO_005 949 3UTR 100% 15.000 10.500 N PRRX1 n/a
6 TRCN0000433136 AGCAGCCAAAGAAACTATATA pLKO_005 1242 3UTR 100% 15.000 10.500 N PRRX1 n/a
7 TRCN0000220233 GTCCCTCCCAAGATGTTGTTT pLKO.1 694 CDS 100% 5.625 3.938 N PRRX1 n/a
8 TRCN0000220232 GCCAAAGTCTTTCTGAAGAAT pLKO.1 1389 3UTR 100% 5.625 3.375 N PRRX1 n/a
9 TRCN0000070710 CGTGTCTTTGAGCGGACACAT pLKO.1 419 CDS 100% 0.495 0.693 N Prrx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006902.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.