Transcript: Human NM_007083.5

Homo sapiens nudix hydrolase 6 (NUDT6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NUDT6 (11162)
Length:
1227
CDS:
26..976

Additional Resources:

NCBI RefSeq record:
NM_007083.5
NBCI Gene record:
NUDT6 (11162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007083.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051478 CCATCCTCCAAAGCCGATTTA pLKO.1 318 CDS 100% 13.200 18.480 N NUDT6 n/a
2 TRCN0000290309 CCATCCTCCAAAGCCGATTTA pLKO_005 318 CDS 100% 13.200 18.480 N NUDT6 n/a
3 TRCN0000051481 GCACAGGGTTACGTGCGGAAT pLKO.1 119 CDS 100% 1.350 1.890 N NUDT6 n/a
4 TRCN0000296562 GGTTGTACAAGATCGAAATAA pLKO_005 502 CDS 100% 15.000 10.500 N NUDT6 n/a
5 TRCN0000051482 GCCATATTCATTCACCATAAA pLKO.1 715 CDS 100% 13.200 9.240 N NUDT6 n/a
6 TRCN0000290310 GCCATATTCATTCACCATAAA pLKO_005 715 CDS 100% 13.200 9.240 N NUDT6 n/a
7 TRCN0000382411 GGAGTTGCAGGAGCTGTATTT pLKO_005 458 CDS 100% 13.200 9.240 N NUDT6 n/a
8 TRCN0000296561 CTGCTTTCACCACGCAGAATC pLKO_005 364 CDS 100% 10.800 7.560 N NUDT6 n/a
9 TRCN0000051479 GCTTCACATCAAGTAGGAGTT pLKO.1 443 CDS 100% 4.050 2.835 N NUDT6 n/a
10 TRCN0000051480 GCAGATTACCAGGATATGCTT pLKO.1 426 CDS 100% 3.000 2.100 N NUDT6 n/a
11 TRCN0000307190 GCAGATTACCAGGATATGCTT pLKO_005 426 CDS 100% 3.000 2.100 N NUDT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007083.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07763 pDONR223 100% 99.8% 100% None 12A>G n/a
2 ccsbBroad304_07763 pLX_304 0% 99.8% 100% V5 12A>G n/a
Download CSV