Transcript: Human NM_007292.6

Homo sapiens acyl-CoA oxidase 1 (ACOX1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ACOX1 (51)
Length:
7317
CDS:
94..2076

Additional Resources:

NCBI RefSeq record:
NM_007292.6
NBCI Gene record:
ACOX1 (51)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007292.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426281 ACTACTGAGTAGTTGATTATT pLKO_005 2381 3UTR 100% 15.000 21.000 N ACOX1 n/a
2 TRCN0000433167 GGAGACCTATCACCGGATTAA pLKO_005 1140 CDS 100% 13.200 18.480 N ACOX1 n/a
3 TRCN0000046198 CGAAAGCCTAACCGAAGCATA pLKO.1 1533 CDS 100% 4.950 6.930 N ACOX1 n/a
4 TRCN0000046201 CGAATCTTACAAGCACCTGAA pLKO.1 2034 CDS 100% 4.050 5.670 N ACOX1 n/a
5 TRCN0000046200 CGCTGAGTAACAAGCTGACTT pLKO.1 896 CDS 100% 4.950 3.960 N ACOX1 n/a
6 TRCN0000424039 TTGCAGTGGTCTTCCAAATAT pLKO_005 1302 CDS 100% 15.000 10.500 N ACOX1 n/a
7 TRCN0000424853 ACAAGTAAACCAGCGTGTAAA pLKO_005 1851 CDS 100% 13.200 9.240 N ACOX1 n/a
8 TRCN0000421311 ATCGCTGACCCTGATGAAATT pLKO_005 328 CDS 100% 13.200 9.240 N ACOX1 n/a
9 TRCN0000046202 GCAGCCAGATTAGTAGAAATT pLKO.1 1564 CDS 100% 13.200 9.240 N ACOX1 n/a
10 TRCN0000418837 GCGCCTGTGTGCAACTCAAAT pLKO_005 2112 3UTR 100% 13.200 9.240 N ACOX1 n/a
11 TRCN0000417340 CGTGAAATCGGGACCCATAAG pLKO_005 721 CDS 100% 10.800 7.560 N ACOX1 n/a
12 TRCN0000417490 TGCCACTATGTGGTAGTTAAG pLKO_005 1684 CDS 100% 10.800 7.560 N ACOX1 n/a
13 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 5765 3UTR 100% 4.950 2.475 Y LOC400464 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5822 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5822 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007292.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05760 pDONR223 100% 95.3% 95.1% None (many diffs) n/a
Download CSV