Transcript: Human NM_007309.3

Homo sapiens diaphanous related formin 2 (DIAPH2), transcript variant 12C, mRNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Homo sapiens (human)
Gene:
DIAPH2 (1730)
Length:
3782
CDS:
397..3687

Additional Resources:

NCBI RefSeq record:
NM_007309.3
NBCI Gene record:
DIAPH2 (1730)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293811 ACGTTATTCTGGAGGTTAATG pLKO_005 2594 CDS 100% 13.200 18.480 N DIAPH2 n/a
2 TRCN0000293812 ATGATGTGCGTGACCGAATTA pLKO_005 554 CDS 100% 13.200 18.480 N DIAPH2 n/a
3 TRCN0000083892 GCACCCTGTCTTCACAAGAAT pLKO.1 872 CDS 100% 5.625 3.938 N DIAPH2 n/a
4 TRCN0000286371 GCACCCTGTCTTCACAAGAAT pLKO_005 872 CDS 100% 5.625 3.938 N DIAPH2 n/a
5 TRCN0000083889 CCTACAAAGAAGAAAGTGAAA pLKO.1 2488 CDS 100% 4.950 3.465 N DIAPH2 n/a
6 TRCN0000286372 CCTACAAAGAAGAAAGTGAAA pLKO_005 2488 CDS 100% 4.950 3.465 N DIAPH2 n/a
7 TRCN0000083890 GCTCAAGAAATGCCCAGTCTT pLKO.1 2936 CDS 100% 4.950 3.465 N DIAPH2 n/a
8 TRCN0000083891 GCAAGCAAAGTTTCAGCTCAA pLKO.1 3106 CDS 100% 4.050 2.835 N DIAPH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10778 pDONR223 100% 99.3% 99.3% None 447_448ins21 n/a
2 ccsbBroad304_10778 pLX_304 0% 99.3% 99.3% V5 447_448ins21 n/a
Download CSV