Transcript: Human NM_007345.3

Homo sapiens zinc finger protein 236 (ZNF236), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ZNF236 (7776)
Length:
8140
CDS:
199..5736

Additional Resources:

NCBI RefSeq record:
NM_007345.3
NBCI Gene record:
ZNF236 (7776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235543 CGTGTTGGCAAGACGAATATT pLKO_005 2017 CDS 100% 15.000 21.000 N ZNF236 n/a
2 TRCN0000235545 CAACGACCTTCGTCCCTATAT pLKO_005 2403 CDS 100% 13.200 18.480 N ZNF236 n/a
3 TRCN0000005507 GCTAACTTGGTTGGACCAAAT pLKO.1 4294 CDS 100% 10.800 15.120 N ZNF236 n/a
4 TRCN0000005505 CGTCCCTATATGTGTCCCTAT pLKO.1 2413 CDS 100% 4.050 5.670 N ZNF236 n/a
5 TRCN0000005506 CCCTGTGTGTAACAAGAAATT pLKO.1 483 CDS 100% 13.200 9.240 N ZNF236 n/a
6 TRCN0000235542 TATCAAGTACAAGGTCTTATA pLKO_005 737 CDS 100% 13.200 9.240 N ZNF236 n/a
7 TRCN0000235544 TTCAGGTCCAGGGTTACATAA pLKO_005 6462 3UTR 100% 13.200 9.240 N ZNF236 n/a
8 TRCN0000005504 CGACACACTTACCGCATCAAT pLKO.1 6436 3UTR 100% 5.625 3.938 N ZNF236 n/a
9 TRCN0000005508 CCAATCCTCATAACTGACTTA pLKO.1 2065 CDS 100% 4.950 3.465 N ZNF236 n/a
10 TRCN0000235546 CTAGTCTCAAAGCGCATATTA pLKO_005 515 CDS 100% 0.000 0.000 N ZNF236 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.