Transcript: Mouse NM_007508.5

Mus musculus ATPase, H+ transporting, lysosomal V1 subunit A (Atp6v1a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1a (11964)
Length:
3946
CDS:
73..1926

Additional Resources:

NCBI RefSeq record:
NM_007508.5
NBCI Gene record:
Atp6v1a (11964)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007508.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029542 CCTACGGGTTGGTAGTCATAT pLKO.1 492 CDS 100% 13.200 18.480 N ATP6V1A n/a
2 TRCN0000240527 CCTACGGGTTGGTAGTCATAT pLKO_005 492 CDS 100% 13.200 18.480 N Atp6v1a n/a
3 TRCN0000280971 CCTACGGGTTGGTAGTCATAT pLKO_005 492 CDS 100% 13.200 18.480 N ATP6V1A n/a
4 TRCN0000182618 GCAAAGATCAAGGCCGACTAT pLKO.1 1855 CDS 100% 4.950 6.930 N Atp6v1a n/a
5 TRCN0000240528 ATGGGCTACCACGTCAGTATG pLKO_005 1090 CDS 100% 10.800 8.640 N Atp6v1a n/a
6 TRCN0000177330 GCAGGAAATACTTCCATTTAA pLKO.1 2389 3UTR 100% 15.000 10.500 N Atp6v1a n/a
7 TRCN0000240526 TAAGATCACATGGTCCATTAT pLKO_005 1761 CDS 100% 13.200 9.240 N Atp6v1a n/a
8 TRCN0000240525 TCTTTAGCAGAGACGGATAAA pLKO_005 1570 CDS 100% 13.200 9.240 N Atp6v1a n/a
9 TRCN0000182482 GCCACCATTCAGGTGTATGAA pLKO.1 256 CDS 100% 5.625 3.938 N Atp6v1a n/a
10 TRCN0000177329 GTCCAACATGATTTCATTCTA pLKO.1 1695 CDS 100% 5.625 3.938 N Atp6v1a n/a
11 TRCN0000181559 GCTTCCATATTGTGCAGCTTT pLKO.1 2002 3UTR 100% 4.950 3.465 N Atp6v1a n/a
12 TRCN0000182110 CCTCTTTAGCAGAGACGGATA pLKO.1 1568 CDS 100% 4.050 2.835 N Atp6v1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007508.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.