Transcript: Mouse NM_007511.2

Mus musculus ATPase, Cu++ transporting, beta polypeptide (Atp7b), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Atp7b (11979)
Length:
4711
CDS:
20..4408

Additional Resources:

NCBI RefSeq record:
NM_007511.2
NBCI Gene record:
Atp7b (11979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101606 GCCGTCACTAAATACTGCAAA pLKO.1 3245 CDS 100% 4.950 6.930 N Atp7b n/a
2 TRCN0000101607 CCCACTAAGAATAGACGGCAT pLKO.1 826 CDS 100% 2.160 3.024 N Atp7b n/a
3 TRCN0000101609 CCTGTGTGTCTAACATAGAAA pLKO.1 1527 CDS 100% 5.625 3.938 N Atp7b n/a
4 TRCN0000101608 GCATAGTGATTGCTGGCTCTA pLKO.1 2634 CDS 100% 4.050 2.835 N Atp7b n/a
5 TRCN0000101605 GCCTTACAGTGTGTGGTGTAT pLKO.1 4550 3UTR 100% 4.950 2.970 N Atp7b n/a
6 TRCN0000043200 CCCATGCTCTTTGTGTTCATT pLKO.1 2327 CDS 100% 5.625 3.938 N ATP7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007511.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.