Transcript: Mouse NM_007654.2

Mus musculus CD72 antigen (Cd72), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Cd72 (12517)
Length:
1482
CDS:
100..1164

Additional Resources:

NCBI RefSeq record:
NM_007654.2
NBCI Gene record:
Cd72 (12517)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066042 CGATGAACCTTCTAAGTATTA pLKO.1 909 CDS 100% 13.200 10.560 N Cd72 n/a
2 TRCN0000066041 CCATGCGGATGGATTCCATAT pLKO.1 796 CDS 100% 10.800 7.560 N Cd72 n/a
3 TRCN0000066039 CCTGAAGAACAGCGCATCTAA pLKO.1 147 CDS 100% 5.625 3.938 N Cd72 n/a
4 TRCN0000066040 CCAGGACACATTACAGGAGAA pLKO.1 600 CDS 100% 4.050 2.835 N Cd72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007654.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.