Transcript: Mouse NM_007731.3

Mus musculus collagen, type XIII, alpha 1 (Col13a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Col13a1 (12817)
Length:
3164
CDS:
473..2692

Additional Resources:

NCBI RefSeq record:
NM_007731.3
NBCI Gene record:
Col13a1 (12817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091750 CAACCCGATAATGTCCCTAAA pLKO.1 1186 CDS 100% 10.800 15.120 N Col13a1 n/a
2 TRCN0000091749 CCAACCCGATAATGTCCCTAA pLKO.1 1185 CDS 100% 4.050 5.670 N Col13a1 n/a
3 TRCN0000442923 ACGAGAAATGGAAGTTCTACT pLKO_005 756 CDS 100% 4.950 3.465 N Col13a1 n/a
4 TRCN0000091752 CCGGGATTCACAGGAGAGAAA pLKO.1 2213 CDS 100% 4.950 3.465 N Col13a1 n/a
5 TRCN0000091751 CGTGTGGGTATCAAAGGTCAA pLKO.1 896 CDS 100% 4.050 2.835 N Col13a1 n/a
6 TRCN0000116266 GAAGATGGCTTACCAGTCCAA pLKO.1 2654 CDS 100% 2.640 1.848 N COL13A1 n/a
7 TRCN0000091748 CTGGCCTGTGTGTGTTTGTAT pLKO.1 2709 3UTR 100% 5.625 3.375 N Col13a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.