Transcript: Mouse NM_007735.2

Mus musculus collagen, type IV, alpha 4 (Col4a4), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Col4a4 (12829)
Length:
7808
CDS:
352..5400

Additional Resources:

NCBI RefSeq record:
NM_007735.2
NBCI Gene record:
Col4a4 (12829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007735.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091804 GCCTGATTTGAGTATCTATAA pLKO.1 1113 CDS 100% 13.200 18.480 N Col4a4 n/a
2 TRCN0000091805 GCCGCCTGATTTGAGTATCTA pLKO.1 1110 CDS 100% 5.625 7.875 N Col4a4 n/a
3 TRCN0000091806 CCTGGAAGACAAGGAAGTAAA pLKO.1 1849 CDS 100% 13.200 9.240 N Col4a4 n/a
4 TRCN0000091803 CGGATGACAAAGACCAGATTA pLKO.1 5715 3UTR 100% 13.200 9.240 N Col4a4 n/a
5 TRCN0000091807 CCAGGCATGAAAGGACAGAAA pLKO.1 2662 CDS 100% 4.950 3.465 N Col4a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007735.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.