Transcript: Mouse NM_007743.3

Mus musculus collagen, type I, alpha 2 (Col1a2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Col1a2 (12843)
Length:
5222
CDS:
223..4341

Additional Resources:

NCBI RefSeq record:
NM_007743.3
NBCI Gene record:
Col1a2 (12843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348516 CCTAACCAAGGATGTACTATG pLKO_005 3784 CDS 100% 10.800 8.640 N Col1a2 n/a
2 TRCN0000090047 CCGTTGGCAAAGATGGTAGAT pLKO.1 3422 CDS 100% 4.950 3.960 N Col1a2 n/a
3 TRCN0000090046 CCTAGCAACATGCCAATATTT pLKO.1 276 CDS 100% 15.000 10.500 N Col1a2 n/a
4 TRCN0000090045 CAACTCTGAAATCTCTCAATA pLKO.1 3650 CDS 100% 13.200 9.240 N Col1a2 n/a
5 TRCN0000335211 CAACTCTGAAATCTCTCAATA pLKO_005 3650 CDS 100% 13.200 9.240 N Col1a2 n/a
6 TRCN0000348588 ATGTTGGCCCATCTGGTAAAG pLKO_005 1613 CDS 100% 10.800 7.560 N Col1a2 n/a
7 TRCN0000090044 GCCAACAAGCATGTCTGGTTA pLKO.1 3904 CDS 100% 4.950 3.465 N Col1a2 n/a
8 TRCN0000090043 GCTGCTCAGTATTCTGACAAA pLKO.1 472 CDS 100% 4.950 3.465 N Col1a2 n/a
9 TRCN0000335210 GCTGCTCAGTATTCTGACAAA pLKO_005 472 CDS 100% 4.950 3.465 N Col1a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.