Transcript: Mouse NM_007789.3

Mus musculus neurocan (Ncan), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Ncan (13004)
Length:
7184
CDS:
125..3931

Additional Resources:

NCBI RefSeq record:
NM_007789.3
NBCI Gene record:
Ncan (13004)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195942 CAGCGACATGGGAGTAGATAT pLKO.1 1504 CDS 100% 13.200 18.480 N Ncan n/a
2 TRCN0000240558 CAGCGACATGGGAGTAGATAT pLKO_005 1504 CDS 100% 13.200 18.480 N Ncan n/a
3 TRCN0000240561 CAGGCGTCGTGTTCCATTATC pLKO_005 594 CDS 100% 13.200 18.480 N Ncan n/a
4 TRCN0000240557 TAAGCTCCCTGCGAGACATTC pLKO_005 321 CDS 100% 10.800 15.120 N Ncan n/a
5 TRCN0000184268 GCCTCAGATCATGTGCATCAA pLKO.1 3778 CDS 100% 4.950 3.960 N Ncan n/a
6 TRCN0000056162 TGCAACTACAACCTACCCTAT pLKO.1 3578 CDS 100% 4.050 3.240 N NCAN n/a
7 TRCN0000240559 TATGCAGCCCTTGCGAGAATG pLKO_005 3132 CDS 100% 10.800 7.560 N Ncan n/a
8 TRCN0000184798 CCAGACTTGACTTGGACACAA pLKO.1 1370 CDS 100% 4.950 3.465 N Ncan n/a
9 TRCN0000240560 CTAGTAATGTGACGATGAATC pLKO_005 2343 CDS 100% 0.000 0.000 N Ncan n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6682 3UTR 100% 4.950 2.475 Y KAAG1 n/a
11 TRCN0000178741 CACACACATACACACACACAA pLKO.1 5302 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.