Transcript: Mouse NM_007806.3

Mus musculus cytochrome b-245, alpha polypeptide (Cyba), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Mus musculus (mouse)
Gene:
Cyba (13057)
Length:
764
CDS:
74..652

Additional Resources:

NCBI RefSeq record:
NM_007806.3
NBCI Gene record:
Cyba (13057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007806.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245375 CCATTGCCAGTGTGATCTATC pLKO_005 417 CDS 100% 10.800 15.120 N Cyba n/a
2 TRCN0000195878 CTCACCAGGAATTACTACGTC pLKO.1 320 CDS 100% 2.640 3.696 N Cyba n/a
3 TRCN0000217794 CGTTTCACACAGTGGTATTTC pLKO.1 167 CDS 100% 13.200 9.240 N Cyba n/a
4 TRCN0000240564 CGTTTCACACAGTGGTATTTC pLKO_005 167 CDS 100% 13.200 9.240 N Cyba n/a
5 TRCN0000240562 TGGACTCCCATTGAGCCTAAA pLKO_005 464 CDS 100% 10.800 7.560 N Cyba n/a
6 TRCN0000240565 GAGCGATGTGGACAGAAGTAC pLKO_005 269 CDS 100% 4.950 3.465 N Cyba n/a
7 TRCN0000240563 ATCAAGCAACCACCTACCAAC pLKO_005 515 CDS 100% 4.050 2.835 N Cyba n/a
8 TRCN0000184095 CATCAAGCAACCACCTACCAA pLKO.1 514 CDS 100% 3.000 2.100 N Cyba n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007806.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.