Transcript: Mouse NM_007842.2

Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 9 (Dhx9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Dhx9 (13211)
Length:
4623
CDS:
151..4302

Additional Resources:

NCBI RefSeq record:
NM_007842.2
NBCI Gene record:
Dhx9 (13211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349797 ACGCCCTCATGCCAGTATAAT pLKO_005 1596 CDS 100% 15.000 21.000 N Dhx9 n/a
2 TRCN0000071116 CGCAAAGTGTTTGATCCAGTA pLKO.1 2242 CDS 100% 4.050 5.670 N Dhx9 n/a
3 TRCN0000071115 GCCTATGAAATTAGAGCAGTA pLKO.1 208 CDS 100% 4.050 3.240 N Dhx9 n/a
4 TRCN0000349840 ATGGAGTAACCAAGGTTATTT pLKO_005 2267 CDS 100% 15.000 10.500 N Dhx9 n/a
5 TRCN0000349799 GACCGAGGAGCCAACCTTAAA pLKO_005 574 CDS 100% 13.200 9.240 N Dhx9 n/a
6 TRCN0000349798 TAAACCCATTTCCCACTTAAT pLKO_005 4387 3UTR 100% 13.200 9.240 N Dhx9 n/a
7 TRCN0000071114 GCGCTTCTTAAATACATTGAA pLKO.1 2071 CDS 100% 5.625 3.938 N Dhx9 n/a
8 TRCN0000312003 GCGCTTCTTAAATACATTGAA pLKO_005 2071 CDS 100% 5.625 3.938 N Dhx9 n/a
9 TRCN0000071113 GCTGGTATCAACCTTATGATT pLKO.1 3586 CDS 100% 5.625 3.938 N Dhx9 n/a
10 TRCN0000071117 CCTCCACAATCCAACTGGAAT pLKO.1 1156 CDS 100% 4.950 3.465 N Dhx9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.