Transcript: Mouse NM_007880.4

Mus musculus AT rich interactive domain 3A (BRIGHT-like) (Arid3a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Arid3a (13496)
Length:
5361
CDS:
474..2279

Additional Resources:

NCBI RefSeq record:
NM_007880.4
NBCI Gene record:
Arid3a (13496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007880.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098041 CGGGAGCAACAGTATTAGCAT pLKO.1 2030 CDS 100% 3.000 4.200 N Arid3a n/a
2 TRCN0000098040 GCCTGGTCTTACAGTTAATTT pLKO.1 3647 3UTR 100% 15.000 10.500 N Arid3a n/a
3 TRCN0000098044 TGAGGGAGATAGGCATTTGAT pLKO.1 821 CDS 100% 5.625 3.938 N Arid3a n/a
4 TRCN0000098042 CCTCGACCTGTTCATGTTGTA pLKO.1 1295 CDS 100% 4.950 3.465 N Arid3a n/a
5 TRCN0000098043 CGACCTGTTCATGTTGTATGT pLKO.1 1298 CDS 100% 4.950 3.465 N Arid3a n/a
6 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 948 CDS 100% 4.950 2.475 Y PTMA n/a
7 TRCN0000165337 GACTTTGAAGAAGAGGAGGCA pLKO.1 939 CDS 100% 0.660 0.396 N LRRN4CL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007880.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.