Transcript: Mouse NM_007924.2

Mus musculus elongation factor RNA polymerase II (Ell), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ell (13716)
Length:
3085
CDS:
33..1841

Additional Resources:

NCBI RefSeq record:
NM_007924.2
NBCI Gene record:
Ell (13716)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353374 GCCGAAGTGCCATCGTCATTA pLKO_005 460 CDS 100% 13.200 18.480 N Ell n/a
2 TRCN0000336142 TTATATGAACTCGGCCCTTTA pLKO_005 1885 3UTR 100% 10.800 15.120 N Ell n/a
3 TRCN0000111893 GCTCTGATGAGTACGAGACAA pLKO.1 1663 CDS 100% 4.950 6.930 N Ell n/a
4 TRCN0000353308 GCTCTGATGAGTACGAGACAA pLKO_005 1663 CDS 100% 4.950 6.930 N Ell n/a
5 TRCN0000111894 CCTGTGACAATGAACCCACAT pLKO.1 1459 CDS 100% 4.050 5.670 N Ell n/a
6 TRCN0000111891 CCCGGACTATTTGCTGAAATA pLKO.1 1493 CDS 100% 1.320 1.848 N Ell n/a
7 TRCN0000336205 TGAGAAGCGACGCTGCGAATA pLKO_005 1745 CDS 100% 10.800 7.560 N Ell n/a
8 TRCN0000336143 TGAGACCTTCCATCCGATTTG pLKO_005 181 CDS 100% 10.800 7.560 N Ell n/a
9 TRCN0000111892 GCTTTGATTGCATCCAACAAT pLKO.1 307 CDS 100% 5.625 3.938 N Ell n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.