Transcript: Mouse NM_007927.3

Mus musculus emerin (Emd), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Emd (13726)
Length:
1601
CDS:
266..1045

Additional Resources:

NCBI RefSeq record:
NM_007927.3
NBCI Gene record:
Emd (13726)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240581 CTACTATGAGGAGAGTTATTT pLKO_005 547 CDS 100% 15.000 21.000 N Emd n/a
2 TRCN0000240585 TGATTGCCTTATCGGTGTTTG pLKO_005 1086 3UTR 100% 10.800 15.120 N Emd n/a
3 TRCN0000216203 CTCTCTGGGCTTATCATATTA pLKO.1 793 CDS 100% 15.000 10.500 N Emd n/a
4 TRCN0000240584 AGCTCTCTGGGCTTATCATAT pLKO_005 791 CDS 100% 13.200 9.240 N Emd n/a
5 TRCN0000176072 GACTACTATGAGGAGAGTTAT pLKO.1 545 CDS 100% 13.200 9.240 N Emd n/a
6 TRCN0000193911 CAGAGCAAGGACTATAATGAT pLKO.1 524 CDS 100% 5.625 3.938 N Emd n/a
7 TRCN0000240582 TACCAGAGCAAGGACTATAAT pLKO_005 521 CDS 100% 0.000 0.000 N Emd n/a
8 TRCN0000240583 ACATCCCTCATGGGCCTATTG pLKO_005 324 CDS 100% 10.800 6.480 N Emd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.