Transcript: Mouse NM_007972.4

Mus musculus coagulation factor X (F10), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
F10 (14058)
Length:
2503
CDS:
264..1709

Additional Resources:

NCBI RefSeq record:
NM_007972.4
NBCI Gene record:
F10 (14058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007972.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423292 GCGGTTACTTCCTGGGTAATG pLKO_005 721 CDS 100% 10.800 15.120 N F10 n/a
2 TRCN0000031749 CGTGGTCATTAAGCACAACAA pLKO.1 1172 CDS 100% 4.950 3.960 N F10 n/a
3 TRCN0000031751 CCTGGGAAAGGTGTGTTTATT pLKO.1 321 CDS 100% 15.000 10.500 N F10 n/a
4 TRCN0000031750 CGAAAGAATACTGGACCAAAT pLKO.1 493 CDS 100% 10.800 7.560 N F10 n/a
5 TRCN0000435854 TCCCTTGACTTCATGGTATAC pLKO_005 1831 3UTR 100% 10.800 7.560 N F10 n/a
6 TRCN0000031753 CCAGTCGAACATCCTGAAGAT pLKO.1 1370 CDS 100% 4.950 3.465 N F10 n/a
7 TRCN0000031752 GAAAGGGAAATATGGCATCTA pLKO.1 1589 CDS 100% 4.950 3.465 N F10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007972.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.