Transcript: Mouse NM_008001.4

Mus musculus FYVE, RhoGEF and PH domain containing 1 (Fgd1), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Fgd1 (14163)
Length:
4166
CDS:
506..3388

Additional Resources:

NCBI RefSeq record:
NM_008001.4
NBCI Gene record:
Fgd1 (14163)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008001.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110020 CGACTCATCTATGACAACAAT pLKO.1 2810 CDS 100% 5.625 7.875 N Fgd1 n/a
2 TRCN0000340739 CAAGATCGATACCTCATATTA pLKO_005 2324 CDS 100% 15.000 12.000 N Fgd1 n/a
3 TRCN0000352455 GAGCGGTCTACCCAGTTTAAA pLKO_005 1958 CDS 100% 15.000 12.000 N Fgd1 n/a
4 TRCN0000340738 TCCCACCAAAGAGCTCATAAA pLKO_005 2260 CDS 100% 13.200 9.240 N Fgd1 n/a
5 TRCN0000340791 CATCTCCTGGATCAGGTATTC pLKO_005 1679 CDS 100% 10.800 7.560 N Fgd1 n/a
6 TRCN0000352456 TCTGCAGCAGTATCATCATTG pLKO_005 1127 CDS 100% 10.800 7.560 N Fgd1 n/a
7 TRCN0000048169 CCACGGCATCTTCTCTAACAT pLKO.1 1756 CDS 100% 5.625 3.938 N FGD1 n/a
8 TRCN0000110023 CAGAAGTCTTTGGAGCTGATA pLKO.1 2135 CDS 100% 4.950 3.465 N Fgd1 n/a
9 TRCN0000110021 CCGACTCATCTATGACAACAA pLKO.1 2809 CDS 100% 4.950 3.465 N Fgd1 n/a
10 TRCN0000110024 GCAAAGAATGGGACCACTCAA pLKO.1 2306 CDS 100% 4.950 3.465 N Fgd1 n/a
11 TRCN0000110022 GCACTAGTTCTGCAGCAGTAT pLKO.1 1119 CDS 100% 0.000 0.000 N Fgd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008001.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.