Transcript: Mouse NM_008012.2

Mus musculus aldo-keto reductase family 1, member B8 (Akr1b8), mRNA.

Source:
NCBI, updated 2018-12-22
Taxon:
Mus musculus (mouse)
Gene:
Akr1b8 (14187)
Length:
1329
CDS:
86..1036

Additional Resources:

NCBI RefSeq record:
NM_008012.2
NBCI Gene record:
Akr1b8 (14187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042203 CCTCACCAGTAAGACAACATT pLKO.1 478 CDS 100% 5.625 3.938 N Akr1b8 n/a
2 TRCN0000042206 GCTGCCTGAGACAGTAAACAT pLKO.1 985 CDS 100% 5.625 3.938 N Akr1b8 n/a
3 TRCN0000042204 GCCATCACGTATACAGGAGAA pLKO.1 883 CDS 100% 4.050 2.835 N Akr1b8 n/a
4 TRCN0000042207 CGCCATATCGACTGCGCGTAT pLKO.1 206 CDS 100% 1.350 0.945 N Akr1b8 n/a
5 TRCN0000042205 CTTTGAGAAGAAACTGCTAAA pLKO.1 334 CDS 100% 10.800 6.480 N Akr1b8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.