Transcript: Mouse NM_008064.4

Mus musculus glucosidase, alpha, acid (Gaa), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gaa (14387)
Length:
3579
CDS:
306..3167

Additional Resources:

NCBI RefSeq record:
NM_008064.4
NBCI Gene record:
Gaa (14387)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008064.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190906 CAAGAGCGTTGTGCAACAATA pLKO.1 1346 CDS 100% 13.200 10.560 N Gaa n/a
2 TRCN0000279458 CAAGAGCGTTGTGCAACAATA pLKO_005 1346 CDS 100% 13.200 10.560 N Gaa n/a
3 TRCN0000191336 CAAGAACAATACCATTGTGAA pLKO.1 2948 CDS 100% 4.950 3.960 N Gaa n/a
4 TRCN0000190112 CCGAAGAGACTTCACCTTCAA pLKO.1 1535 CDS 100% 4.950 3.960 N Gaa n/a
5 TRCN0000279470 CCGAAGAGACTTCACCTTCAA pLKO_005 1535 CDS 100% 4.950 3.960 N Gaa n/a
6 TRCN0000279398 ATCTCATGCTTCGGGAGTTAA pLKO_005 391 CDS 100% 13.200 9.240 N Gaa n/a
7 TRCN0000279461 TGCTCTCCTGACACATCTTTG pLKO_005 3255 3UTR 100% 10.800 7.560 N Gaa n/a
8 TRCN0000189432 CCAAGAGCGTTGTGCAACAAT pLKO.1 1345 CDS 100% 5.625 3.938 N Gaa n/a
9 TRCN0000189609 CGCCTCCACTTCAAGATCAAA pLKO.1 837 CDS 100% 5.625 3.938 N Gaa n/a
10 TRCN0000279469 CGCCTCCACTTCAAGATCAAA pLKO_005 837 CDS 100% 5.625 3.938 N Gaa n/a
11 TRCN0000189608 CCCTGAAGCTCTGTGTTCTTA pLKO.1 3305 3UTR 100% 5.625 3.375 N Gaa n/a
12 TRCN0000049553 CGCTACATGATGATCGTGGAT pLKO.1 1614 CDS 100% 2.640 2.112 N GAA n/a
13 TRCN0000290341 CGCTACATGATGATCGTGGAT pLKO_005 1614 CDS 100% 2.640 2.112 N GAA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008064.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.