Transcript: Mouse NM_008074.2

Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit gamma 3 (Gabrg3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gabrg3 (14407)
Length:
1673
CDS:
99..1502

Additional Resources:

NCBI RefSeq record:
NM_008074.2
NBCI Gene record:
Gabrg3 (14407)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008074.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088959 CCTGGTCTATTGGGTTGGATA pLKO.1 1469 CDS 100% 4.950 6.930 N Gabrg3 n/a
2 TRCN0000088960 GCCTTCAAGCACCCTCTAATT pLKO.1 1204 CDS 100% 13.200 10.560 N Gabrg3 n/a
3 TRCN0000063055 CCTTCGATTCAACAGCACAAT pLKO.1 416 CDS 100% 4.950 3.465 N GABRG3 n/a
4 TRCN0000088958 CTGAGGGATGACTGAAGAGTA pLKO.1 1511 3UTR 100% 4.950 3.465 N Gabrg3 n/a
5 TRCN0000088961 GCGGCTCTATCAGTTTGACTT pLKO.1 746 CDS 100% 4.950 3.465 N Gabrg3 n/a
6 TRCN0000088962 CAAGATGGATTCCTGATCGAA pLKO.1 1180 CDS 100% 3.000 2.100 N Gabrg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008074.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.