Transcript: Mouse NM_008093.2

Mus musculus GATA binding protein 5 (Gata5), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gata5 (14464)
Length:
3302
CDS:
311..1525

Additional Resources:

NCBI RefSeq record:
NM_008093.2
NBCI Gene record:
Gata5 (14464)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085532 ACCGGACACTATCTATGCAAT pLKO.1 944 CDS 100% 4.950 6.930 N Gata5 n/a
2 TRCN0000085530 GCATACATGAGTTCCGACGTA pLKO.1 740 CDS 100% 2.640 3.696 N Gata5 n/a
3 TRCN0000412580 CATACTCCAGGCAGGCAATAA pLKO_005 1861 3UTR 100% 13.200 10.560 N Gata5 n/a
4 TRCN0000434198 ACAAGCAGTTGCCGCTGATTC pLKO_005 505 CDS 100% 10.800 7.560 N Gata5 n/a
5 TRCN0000415227 CGTCTTCATTTCCCGTGTTTG pLKO_005 1906 3UTR 100% 10.800 7.560 N Gata5 n/a
6 TRCN0000423942 CCAAGGCCACTGGCAATGAAA pLKO_005 1160 CDS 100% 5.625 3.938 N Gata5 n/a
7 TRCN0000085531 GAGTTCAAGTTCGAACCTGAA pLKO.1 1412 CDS 100% 4.050 2.835 N Gata5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.