Transcript: Mouse NM_008102.3

Mus musculus GTP cyclohydrolase 1 (Gch1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gch1 (14528)
Length:
2764
CDS:
136..861

Additional Resources:

NCBI RefSeq record:
NM_008102.3
NBCI Gene record:
Gch1 (14528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008102.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295398 TTGTAGGAAGGGTCCATATTG pLKO_005 551 CDS 100% 13.200 10.560 N Gch1 n/a
2 TRCN0000101709 CGACACACATGTGCATGGTAA pLKO.1 731 CDS 100% 4.950 3.960 N Gch1 n/a
3 TRCN0000288063 CGACACACATGTGCATGGTAA pLKO_005 731 CDS 100% 4.950 3.960 N Gch1 n/a
4 TRCN0000307551 GCATGCATTTGGTTGACATAA pLKO_005 1160 3UTR 100% 13.200 9.240 N Gch1 n/a
5 TRCN0000101707 CTCAGTAAACTTGCCAGGATT pLKO.1 601 CDS 100% 4.950 3.465 N Gch1 n/a
6 TRCN0000288065 CTCAGTAAACTTGCCAGGATT pLKO_005 601 CDS 100% 4.950 3.465 N Gch1 n/a
7 TRCN0000101705 GCCAAATCAAATCGCAGCATT pLKO.1 2046 3UTR 100% 4.950 3.465 N Gch1 n/a
8 TRCN0000101706 GCAGTACTTCACCAAGGGATA pLKO.1 414 CDS 100% 4.050 2.835 N Gch1 n/a
9 TRCN0000288139 GCAGTACTTCACCAAGGGATA pLKO_005 414 CDS 100% 4.050 2.835 N Gch1 n/a
10 TRCN0000101708 CTTCCTAACAAGCAAGTCCTT pLKO.1 577 CDS 100% 2.640 1.848 N Gch1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008102.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.