Transcript: Mouse NM_008110.2

Mus musculus growth differentiation factor 9 (Gdf9), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gdf9 (14566)
Length:
1805
CDS:
121..1446

Additional Resources:

NCBI RefSeq record:
NM_008110.2
NBCI Gene record:
Gdf9 (14566)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437219 TGCAGTGTCCGTAGGTGTAAA pLKO_005 1598 3UTR 100% 13.200 18.480 N Gdf9 n/a
2 TRCN0000421438 TGGTCCAGAATATAATCTATG pLKO_005 1283 CDS 100% 10.800 15.120 N Gdf9 n/a
3 TRCN0000068226 GCAGAAGTCACCTCTACAATA pLKO.1 437 CDS 100% 13.200 9.240 N Gdf9 n/a
4 TRCN0000437629 CCGTGAAAGAGGAAGCTATTG pLKO_005 989 CDS 100% 10.800 7.560 N Gdf9 n/a
5 TRCN0000068223 CCAAGTGAAATGTAACTCATT pLKO.1 1647 3UTR 100% 4.950 3.465 N Gdf9 n/a
6 TRCN0000068227 CCATGACTTCAGACTGAGTTT pLKO.1 1146 CDS 100% 4.950 3.465 N Gdf9 n/a
7 TRCN0000068224 GCCATGGAACACTTGCTCAAA pLKO.1 565 CDS 100% 4.950 3.465 N Gdf9 n/a
8 TRCN0000068225 GCCACTTCTTACAGCATCCTT pLKO.1 1071 CDS 100% 3.000 2.100 N Gdf9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.