Transcript: Mouse NM_008140.2

Mus musculus guanine nucleotide binding protein, alpha transducing 1 (Gnat1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gnat1 (14685)
Length:
2222
CDS:
45..1097

Additional Resources:

NCBI RefSeq record:
NM_008140.2
NBCI Gene record:
Gnat1 (14685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054433 CGAGACTCAATTCTCCTTCAA pLKO.1 587 CDS 100% 4.950 6.930 N Gnat1 n/a
2 TRCN0000054436 CACAACGTCTATCGTGCTCTT pLKO.1 812 CDS 100% 4.050 5.670 N Gnat1 n/a
3 TRCN0000054435 GAGCTTAACATGCGACGTGAT pLKO.1 957 CDS 100% 4.050 3.240 N Gnat1 n/a
4 TRCN0000054434 CAGAACGTCAAGTTTGTCTTT pLKO.1 1020 CDS 100% 4.950 3.465 N Gnat1 n/a
5 TRCN0000054437 CCTCGAGTTCATTGCCATCAT pLKO.1 230 CDS 100% 0.000 0.000 N Gnat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00653 pDONR223 100% 89.3% 99.4% None (many diffs) n/a
2 ccsbBroad304_00653 pLX_304 0% 89.3% 99.4% V5 (many diffs) n/a
Download CSV