Transcript: Mouse NM_008208.4

Mus musculus histocompatibility 2, T region locus 3 (H2-T3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
H2-T3 (15043)
Length:
2178
CDS:
24..1178

Additional Resources:

NCBI RefSeq record:
NM_008208.4
NBCI Gene record:
H2-T3 (15043)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008208.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114054 CGCGATTACATTGCCCTCAAT pLKO.1 462 CDS 100% 4.950 2.970 N H2-T3 n/a
2 TRCN0000433735 GAACGAGAGGAAGGCCTTTGA pLKO_005 1327 3UTR 100% 4.950 2.970 N H2-T3 n/a
3 TRCN0000192720 GCCCTCAATGAAGATCTGAAA pLKO.1 474 CDS 100% 4.950 2.970 N H2-T3 n/a
4 TRCN0000445982 ACCCTACATTAGCTGTCATCC pLKO_005 1542 3UTR 100% 4.050 2.430 N H2-T3 n/a
5 TRCN0000114053 AGACGATAACACTGCTGCATA pLKO.1 1049 CDS 100% 4.950 2.475 Y H2-T3 n/a
6 TRCN0000114051 GCCTGGTTTACAGAGTGAGTT pLKO.1 1783 3UTR 100% 4.950 2.475 Y H2-T3 n/a
7 TRCN0000114055 GTCACAAGCAATGCACAGTTT pLKO.1 300 CDS 100% 4.950 2.475 Y H2-T3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008208.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.