Transcript: Mouse NM_008249.5

Mus musculus transcription factor B2, mitochondrial (Tfb2m), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tfb2m (15278)
Length:
2464
CDS:
146..1336

Additional Resources:

NCBI RefSeq record:
NM_008249.5
NBCI Gene record:
Tfb2m (15278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008249.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350949 AGTACGGTTGATCCTATTAAT pLKO_005 1166 CDS 100% 15.000 7.500 Y Tfb2m n/a
2 TRCN0000337791 TGGAGCTGTTTGTCCATTATT pLKO_005 1363 3UTR 100% 15.000 7.500 Y Tfb2m n/a
3 TRCN0000081604 GCGGCTTCTCTGACTTCAATA pLKO.1 267 CDS 100% 13.200 6.600 Y Tfb2m n/a
4 TRCN0000288499 GCGGCTTCTCTGACTTCAATA pLKO_005 267 CDS 100% 13.200 6.600 Y Tfb2m n/a
5 TRCN0000081605 CGAGTAGAACTGAATATGTTT pLKO.1 803 CDS 100% 5.625 2.813 Y Tfb2m n/a
6 TRCN0000288571 CGAGTAGAACTGAATATGTTT pLKO_005 803 CDS 100% 5.625 2.813 Y Tfb2m n/a
7 TRCN0000081606 GCGTCACATAGCATGTAAGAA pLKO.1 358 CDS 100% 5.625 2.813 Y Tfb2m n/a
8 TRCN0000288572 GCGTCACATAGCATGTAAGAA pLKO_005 358 CDS 100% 5.625 2.813 Y Tfb2m n/a
9 TRCN0000081607 CGTAGGACTTTATTTACAGAA pLKO.1 1049 CDS 100% 4.950 2.475 Y Tfb2m n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008249.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.