Transcript: Mouse NM_008359.2

Mus musculus interleukin 17 receptor A (Il17ra), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Il17ra (16172)
Length:
3970
CDS:
133..2727

Additional Resources:

NCBI RefSeq record:
NM_008359.2
NBCI Gene record:
Il17ra (16172)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008359.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366615 GCTACTTAAGAGGGTGTATAT pLKO_005 2741 3UTR 100% 13.200 18.480 N Il17ra n/a
2 TRCN0000366616 CTTCGGCACCTACGTTGTTTG pLKO_005 1626 CDS 100% 10.800 15.120 N Il17ra n/a
3 TRCN0000366544 AGCTGCTTTGATGTCGTTAAA pLKO_005 862 CDS 100% 13.200 9.240 N Il17ra n/a
4 TRCN0000375450 ATGAGCATCTGGTCATCATTG pLKO_005 3048 3UTR 100% 10.800 7.560 N Il17ra n/a
5 TRCN0000379246 CTATGTGGAGGTGGTCCTAAA pLKO_005 1308 CDS 100% 10.800 7.560 N Il17ra n/a
6 TRCN0000375452 GACAGATTTGAGGAGGTTTAC pLKO_005 1720 CDS 100% 10.800 7.560 N Il17ra n/a
7 TRCN0000068057 CCACAAATCCAAGATCATCTT pLKO.1 654 CDS 100% 4.950 3.465 N Il17ra n/a
8 TRCN0000068053 CGGAGAATTAGTCCCTGTGTT pLKO.1 393 CDS 100% 4.950 3.465 N Il17ra n/a
9 TRCN0000068056 GCTACTTCAGTGGCATCTGTA pLKO.1 1646 CDS 100% 4.950 3.465 N Il17ra n/a
10 TRCN0000068054 CCCTGCCCAGTAATCTCAAAT pLKO.1 1036 CDS 100% 13.200 7.920 N Il17ra n/a
11 TRCN0000068055 CCCAAGCAAAGTGGAAAGCTA pLKO.1 1490 CDS 100% 3.000 1.800 N Il17ra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008359.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.