Transcript: Mouse NM_008367.3

Mus musculus interleukin 2 receptor, alpha chain (Il2ra), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Il2ra (16184)
Length:
4428
CDS:
210..1016

Additional Resources:

NCBI RefSeq record:
NM_008367.3
NBCI Gene record:
Il2ra (16184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068021 CATTAACCATAGTACCCAGTT pLKO.1 244 CDS 100% 4.050 5.670 N Il2ra n/a
2 TRCN0000068020 CGAGTGTATTCCGGGATACAA pLKO.1 647 CDS 100% 0.563 0.450 N Il2ra n/a
3 TRCN0000068018 CGGAGACATTTGTGCTCACAA pLKO.1 886 CDS 100% 4.950 3.465 N Il2ra n/a
4 TRCN0000068022 CTGGCTAGTGAGGAATCTCAA pLKO.1 777 CDS 100% 4.950 3.465 N Il2ra n/a
5 TRCN0000059166 CTGTGAATGCAAGAGAGGTTT pLKO.1 353 CDS 100% 4.950 3.465 N IL2RA n/a
6 TRCN0000068019 GCTCAACTTGAACACCAGAAA pLKO.1 480 CDS 100% 4.950 3.465 N Il2ra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008367.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.