Transcript: Mouse NM_008417.5

Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 2 (Kcna2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Kcna2 (16490)
Length:
11582
CDS:
682..2181

Additional Resources:

NCBI RefSeq record:
NM_008417.5
NBCI Gene record:
Kcna2 (16490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008417.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069165 GCGGTTCGAAACTCAGCTAAA pLKO.1 807 CDS 100% 10.800 15.120 N Kcna2 n/a
2 TRCN0000069166 CTACCATAAGTAAGTCTGATT pLKO.1 2033 CDS 100% 4.950 6.930 N Kcna2 n/a
3 TRCN0000426692 GTCTGATTGAAGCCTACTAAT pLKO_005 2176 CDS 100% 13.200 10.560 N Kcna2 n/a
4 TRCN0000440468 GAGATACAGGAGGGAGTTAAC pLKO_005 2059 CDS 100% 10.800 7.560 N Kcna2 n/a
5 TRCN0000069164 CCAGGATTATAGCCATTGTAT pLKO.1 1166 CDS 100% 5.625 3.938 N Kcna2 n/a
6 TRCN0000044083 GCAAGTGACAAGCTGTCCAAA pLKO.1 1971 CDS 100% 4.950 3.465 N KCNA2 n/a
7 TRCN0000069163 GCCTGCATTGTAGTCAGTGTT pLKO.1 2239 3UTR 100% 4.950 3.465 N Kcna2 n/a
8 TRCN0000044085 GCTAACACAAACTATGTGAAT pLKO.1 2134 CDS 100% 4.950 3.465 N KCNA2 n/a
9 TRCN0000069167 CCCTTAGATATCTTCTCGGAA pLKO.1 994 CDS 100% 2.640 1.848 N Kcna2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7270 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008417.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10930 pDONR223 100% 63% 61.6% None (many diffs) n/a
2 ccsbBroad304_10930 pLX_304 0% 63% 61.6% V5 (many diffs) n/a
Download CSV